-
Filter Hybridization과 Solution Hybridization 방법에 의한 백서 Surfactant Protein C mRNA 정량측정의 비교
김진호, 손장원, 양석철, 윤호주, 신동호, 박성수, Kim. Jin-Ho, Sohn. Jang-Won, Yang. Seok-Chul, Yoon. Ho-Joo, Shin. Dong-Ho, Park. Sung-Soo 대한결핵및호흡기학회 결핵 및 호흡기 질환 13 Pages
대한결핵및호흡기학회 결핵 및 호흡기 질환 2001, Vol.51 No.6 517-529 (13 pages)
Filter hybridization이나 solution hybridization 방법들은 Northern blot나 slot blot에 비하여 빠르며 재현성이 높고 소량의 RNA를 측정할 수 있으며 한꺼번에 많은 시료들을 동시에 측정하는것이 가능하다. 방 법 : 저자들은 쥐를 대상으로 하여 SP-C mRNA를 filter hybridization과 solution hybridization 방법들로 각각 정량측정하여 방법론에 따른 분자생물학적 정도관리에 대한 관찰을 하기 위하여 이 연구를 시행하였다. 결 과 : 1) Solution hybridization 방법에 의한 SP-C mRNA의 정량측정을 위한 RNA 검체물의 최소량은 3pg... -
Filter Hybridization 방법에 의한 Surfactant Protein B mRNA의 정량측정
박성수, 이동후, 신동호, 이정희, Park. Sung-Soo, Lee. Dong-Hoo, Shin. Dong-Ho, Lee. Jung-Hee 대한결핵및호흡기학회 결핵 및 호흡기 질환 6 Pages
대한결핵및호흡기학회 결핵 및 호흡기 질환 1992, Vol.39 No.3 242-247 (6 pages)
coding 부위를 PGem 3Z 또는 4Z에 subclone하여 SP6 RNA polymerase 효소를 이용하여 antisense와 sense을 얻었다. Sense을 이용한 filter hybridization올 시행하여 정상곡선을 얻었다. Antisense는 $^{32}P$를 표지시켜 탐지자로 이용하였다. 결과 : SP-B에 대한 sense 복사체의 정상곡선은 Y=2034.9X+159.1(X=SP-BmRNA 복사체, Y=CPM)이고, 상관계수는 1.0이었다. 결론 : 이상의 결과로 filter hybridization 방법은 mRNA을 정량측정 하는데 있어서 빠르고, 재현성이 높으며, 많은 시료를 한꺼번에 시행할 수 있는 유용한 방법이다. -
Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization
한국식물병리학회 The Plant Pathology Journal 7 Pages
한국식물병리학회 The Plant Pathology Journal 2017, 33권 1호 9 80-86 (7 pages)
5 min and immediately placed on ice. After pre-hybridization (Step 4-1), the membrane held by the silicone filter folder is transferred into the new tube containing 1.7 ml of the preheated PerfectHyb hybridiza- tion solution (Toyobo) plus 15 μl of the denatured PCR products, and incubated at 69 oC overnight (hybridization). After hybridization (Step 4-2), the membrane with a sili- con holder... PCR-amplified probes and microtube hybridization (MTH) using a macroarray. The initial culturing step is convenient to lure the fungi out of the plant tissues, and to extract PCR-inhibitor-free DNA directly from fungal hyphae. For specific detection of the fungi, PCR primers were designed to amplify the fungal MAT1-2 gene. The subsequent MTH step using the PCR products as probes can replace the laborious electrophoresis step providing us sequence information and high-throughput screening. Using... -
An overview of calf diarrhea - infectious etiology, diagnosis, and intervention
Yong-il Cho, Kyoung-Jin Yoon* 대한수의학회 Journal of Veterinary Science 17 Pages
대한수의학회 Journal of Veterinary Science 2014, 제 15권 제 1호 1 1-17 (17 pages)
S, Kramer FR. Real-time assays with molecular beacons and other fluorescent nucleic acid hybridization probes. Clin Chim Acta 2006, 363, 48-60. 81. Martella V, Banyai K, Matthijnssens J, Buonavoglia C, Ciarlet M. Zoonotic aspects of rotaviruses. Vet Microbiol 2010, 140, 246-255. 82. Martella V, Ciarlet M, Banyai K, Lorusso E, Arista S, Lavazza A, Pezzotti G, Decaro N, Cavalli A, Lucente MS,... Calf diarrhea is a commonly reported disease in young animals, and still a major cause of productivity and economic loss to cattle producers worldwide. In the report of the 2007 National Animal Health Monitoring System for U.S. dairy, half of the deaths among unweaned calves was attributed to diarrhea. Multiple pathogens are known or postulated to cause or contribute to calf diarrhea development. Other factors including both the environment and management practices influence disease severity or... -
Low numbers of intestinal Shiga toxin-producing E. coli correlate with a poor prognosis in sheep infected with bovine leukemia virus
Witold A. Ferens, Julius Haruna, Rowland Cobbold, Carolyn J. Hovde* 대한수의학회 Journal of Veterinary Science 6 Pages
대한수의학회 Journal of Veterinary Science 2008, 제 9권 제 4호 6 375-380 (6 pages)
by isolation of CFU on hydrophobic-grid filters [20] and colony hybridization with stx-specific DNA probes [13] by a modified procedure of Nizetic et al. [16]. Carriage of STEC over time was compared among individual animals using an STEC score = (the average logarithms of STEC CFU/g feces × the proportion of STEC-positive samples). STEC measurements from June to September (3 × before and... Healthy ruminants carry intestinal Shiga toxin (Stx)- producing Escherichia coli (STEC). Stx has antiviral activities in vitro and STEC numbers correlate with reduced early viremia in sheep experimentally infected with bovine leukemia virus (BLV). This study assessed the impact of intestinal STEC on BLV-induced disease for one year post-BLV-challenge. High STEC scores (CFU/g feces × frequency of STEC-positive samples) correlated with good health, whereas poor weight gain, distress, and... -
Aquaporin 1 expression in tissues of canines possessing inherited high K erythrocytes
Hideharu Ochiai*, Nobuya Hishiyama, Shin Hisamatsu, Nobuyuki Kanemaki 대한수의학회 Journal of Veterinary Science 4 Pages
대한수의학회 Journal of Veterinary Science 2008, 제 9권 제 2호 12 203-206 (4 pages)
AB038240 3' 637-657 GATGACCTTGCCCACAGCCTT Fig. 1. Northern blot analysis of AQP1 expression in dog tissues (A). Each 10 μg sample of mRNA was purified, electropho- resed, and blotted. Hybridization of this blot with glyce- raldehyde-3-phosphate dehydrogenase (GAPDH) to ensure RNA integrity is also shown (B). AQP1 expression of each tissue was standardized using the signal intensity of GAPDH (C).... We investigated the expression of aquaporin 1 (AQP1) in tissues from canines with an inherited anomaly that causes their erythrocytes to have high K. Northern blot analysis revealed abundant AQP1 expression in lung and kidney, though little expression was found in spleen. Using anti- C-terminus for dog AQP1, abundant expression was shown in kidney, trachea, and eye, but little expression was shown in pancreas and cerebrum, indicating that AQP1 expression in canine tissues is similar to that... -
Hangover relieving effect of Sanghwang mushroom mycelium cultured in germinated buckwheat
Yoo-jin An , Sung-min Cho , Min-su Kim , Hae-hee Moon , Dong- Soo Park , Nam-gen Jeon , Youngjae Lee , Chang-hoon Han 대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 8 Pages
대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 2017, 제 57권 제 3호 1 147-154 (8 pages)
efficiency, fragmentation of cRNA was performed by adding 10× block- ing agent and 25× fragmentation buffer and incubating at 60 oC for 30 min. The fragmented cRNA was resuspended with 2× hybridization buffer and directly pipetted onto assembled Agilent’s Mouse Oligo Microarray (44 K). The arrays hybrid- ized at 65 oC for 17 h using Agilent Hybridization oven (Agi- lent Technology). The... -
Expression of the S glycoprotein of transmissible gastroenteritis virus (TGEV)in transgenic potato and its immunogenicity in mice
Dong Joo Ahn , Jung Won Youm , Suk Weon Kim , Won Kee Yoon , Hyoung Chin Kim , Tai Young Hur , Young Hee Joung , Jae Heu 대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 8 Pages
대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 2013, 제 53권 제 4호 5 217-224 (8 pages)
S 0.7 probe, which was generated with the PCR DIG Labeling Mix (Roche Diagnostics, Germany) using the specific primer set for the TGEV-S 0.7 gene. After hybridization overnight, membrane hybridization was detected using the DIG Detec- tion Kit following the manufacturer’s instructions (Roche Diagnostics). Northern blotting: RNA for northern blotting was extracted using the RNAgents Total RNA... -
Differential gene expression pattern in brains of acrylamide-administered mice
Chang Hoon Han 대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 6 Pages
대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 2012, 제 52권 제 2호 6 99-104 (6 pages)
L of hybridization solution consisting of 2× Denhardt’s solution, 4.5% SDS, 1× SSC, 1 mM EDTA, 0.25 M Na 2HPO4, and 0.05 mg/mL yeast tRNA. Labeled cDNAs was denaturized at 95 oC for 2 min, and incubated in 45 oC water chamber for 20 min, then placed on the spotted slide position and covered by a cover slip (22 mm × 22 mm). The slides were hybridized for 14 h in 62 oC hybridization chamber. The... -
미생물,면역학 : 도축돈 장분변으로부터 Shiga Toxin-Producing Escherichia coli의 분리와 성상
송영환, 김지영, 채미경, 박창식 대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 9 Pages
대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 2004, 제 44권 제 4호 9 551-559 (9 pages)
18 2l EDTA . . 4M lithium chloride 100% ethanol . . 50 l TE (100 mM Tris- Cl, pH 8.0, 1 mM EDTA). . digoxigenin . gene probe DNA . Nylon membrane (Boehringer Mannheim, Germany) LB agar. . . . 5. . filter paper (Whatmann, Germany) . (0.5N NaOH, 1.5M NaCl) 15. , (1.5M NaCl, 1M Tris) 15 . . . , 2X SSC(0.3M NaCl, 30 mM Sodium citrate, pH 7.0) 15. . . 30. 80 oC DNA . . kit . hybridization . , STE...


전체 선택해제

총

