주제분류
- 의약학(196)
- 농수해양학(142)
- 자연과학(87)
- 교육학(38)
- 사회과학(27)
- 유아교육학(23)
- 심리학(16)
- 보건학(10)
- 예체능(9)
- 기타(7)
- 사회복지학(4)
- 특수교육학(4)
- 공학(3)
- 인문학(3)
- 종교(2)
자료유형
발행기관
- 대한수의학회(142)
- 대한생리학회-대한약리학회(122)
- 한국탄소학회(43)
- 한국식물병리학회(38)
- 환태평양유아교육연구학회(23)
- 대한약리학회(22)
- 인문사회과학기술융합학회(17)
- 대한생리학회(15)
- 대한신경정신의학회(8)
- 물리치료재활과학회(7)
- 대한치과이식임플란트학회(6)
- 이화여자대학교 교과교육연구소(6)
- 한국교육학회(6)
- 한국미술치료학회(6)
- 한국습지학회(6)
- 한국음악교육학회(6)
- 대한구순구개열학회(5)
- 대한치과교정학회(5)
- 한국의학교육학회(5)
- 한국헬스커뮤니케이션학회(5)
- 한국가족치료학회(4)
- 한국광고PR실학회(4)
- 한국교육방법학회(4)
- 한국기초간호학회(4)
- 부산대학교 교육발전연구소(3)
- 한국기업교육학회(3)
- 한국성인교육학회(3)
- 한국시각장애교육재활학회(3)
- 한국열환경공학회(3)
- 한국음악교육공학회(3)
- 경인교육대학교 교육연구원(2)
- 고령자치매작업치료학회(2)
- 대한신경계작업치료학회(2)
- 한국교육치료학회(2)
- 한국동서정신과학회(2)
- 한국박물관학회(2)
- 한국불교상담학회(2)
- 한국인간발달학회(2)
- 한국장애인복지학회(2)
- 공주교육대학교 초등교육연구원(1)
- 동아시아문화학회(1)
- 인지발달중재학회(1)
- 한국경호경비학회(1)
- 한국교원교육학회(1)
- 한국교육사회학회(1)
- 한국교육원리학회(1)
- 한국국제이해교육학회(1)
- 한국노인작업치료학회(1)
- 한국독서교육학연구회(1)
- 한국문화예술교육학회(1)
- 한국보건기초의학회(1)
- 한국보육지원학회(1)
- 한국심리치료학회(1)
- 한국아동심리치료학회(1)
- 한국여가문화학회(1)
- 한국연극예술치료학회(1)
- 한국웰니스학회(1)
- 한국음악치료학회(1)
- 한국임상사회사업학회(1)
- 한국조형교육학회(1)
- 한국창의력교육학회(1)
- 한국청각언어재활학회(1)
- 한국통합교육학회(1)
- 한국항공우주학회(1)
- 한방비만학회(1)
간행물
- THE KOREAN JOURNAL OF PHYSIOLOGY & PHARMACOLOGY(122)
- JOURNAL OF VETERINARY SCIENCE(121)
- CARBON LETTERS(43)
- THE PLANT PATHOLOGY JOURNAL (38)
- ASIA-PACIFIC JOURNAL OF RESEARCH IN EARLY CHILDHOOD EDUCATION(23)
- 대한약리학잡지(22)
- KOREAN JOURNAL OF VETERINARY RESEARCH(구 대한수의학회지)(18)
- 예술인문사회융합멀티미디어논문지(17)
- 대한생리학회지(15)
- 신경정신의학(8)
- PHYSICAL THERAPY REHABILITATION SCIENCE(7)
- JOURNAL OF DENTAL IMPLANT RESEARCH(6)
- 교과교육학연구(6)
- 미술치료연구(6)
- 음악교육연구(6)
- 한국습지학회지(6)
- KOREAN JOURNAL OF MEDICAL EDUCATION(5)
- THE KOREAN JOURNAL OF ORTHODONTICS(5)
- 교육학연구(5)
- 대한구순구개열학회지(5)
- 헬스커뮤니케이션연구(5)
- JOURNAL OF KOREAN BIOLOGICAL NURSING SCIENCE(4)
- 가족과 가족치료(4)
- 광고PR실학연구(4)
- 교육방법연구(4)
- ANDRAGOGY TODAY(3)
- 기업교육과 인재연구(3)
- 대한수의학회 학술대회발표집(3)
- 시각장애연구(3)
- 열환경공학(3)
- 음악교육공학(3)
- 고령자-치매작업치료학회지(2)
- 교육논총(2)
- 교육치료연구(2)
- 교육혁신연구(2)
- 동서정신과학(2)
- 박물관학보(2)
- 불교상담학연구(2)
- 인간발달연구(2)
- 재활치료과학(2)
- 한국장애인복지학(2)
- AUDIOLOGY AND SPEECH RESEARCH(1)
- THE JOURNAL OF EDUCATION(1)
- 교육연구(1)
- 교육원리연구(1)
- 국제이해교육연구(1)
- 대한한방비만학회지(1)
- 독서교육연구(1)
- 동아시아문화와예술(1)
- 모드니예술(1)
- 시큐리티연구(1)
- 여가학연구(1)
- 연극예술치료연구(1)
- 인지발달중재학회지(1)
- 임상사회사업연구(1)
- 조형교육(1)
- 창의력교육연구(1)
- 통합교육연구(1)
- 한국교원교육연구(1)
- 한국교육사회학회 학술대회자료집(1)
- 한국교육학회 학술대회논문집(1)
- 한국노인작업치료학회지(1)
- 한국보건기초의학회지(1)
- 한국보육지원학회지(1)
- 한국심리치료학회지(1)
- 한국아동심리치료학회지(1)
- 한국웰니스학회지(1)
- 한국음악치료학회지(1)
- 한국항공우주학회지(1)
전체 선택해제
총 571건 검색
본문검색 결과만 보기
-
Evaluation of changes in left ventricular myocardial function observed in canine myocardial dysfunction model using a two-dimensional tissue tracking technique
Lina Hamabe, Ryuji Fukushima, Keisuke Kawamura, Yusuke Shinoda, Hsu Huai-Che, Shuji Suzuki, Derya Aytemiz, Toshiroh Iwasaki, Ryo 대한수의학회 Journal of Veterinary Science 8 Pages
대한수의학회 Journal of Veterinary Science 2013, 제 14권 제 3호 16 355-362 (8 pages)
distribution, and reproduction in any medium, provided the original work is properly cited. Evaluation of changes in left ventricular myocardial function observed in canine myocardial dysfunction model using a two-dimensional tissue tracking technique Lina Hamabe 1 , Ryuji Fukushima 1 , Keisuke Kawamura 1 , Yusuke Shinoda 1 , Hsu Huai-Che 1 , Shuji Suzuki 1 , Derya Aytemiz 1 , Toshiroh Iwasaki... This study was conducted to assess the ability of two-dimensional tissue tracking (2DTT) to evaluate changes in left ventricular (LV) myocardial function associated with sustained high electrical pacing. Pacemakers were implanted at the right ventricular (RV) apex of five female Beagles, and sustained high electrical pacing of 250 beats per minute (bpm) was performed for three consecutive weeks. Conventional echocardiography and 2DTT were performed at baseline, and at every week for three weeks... -
Magnetic resonance imaging characteristics of ischemic brain infarction over time in a canine stroke model
Sooyoung Choi, Daji Noh, Youngwhan Kim, Inseong Jeong, Hojung Choi, Youngwon Lee, Kija Lee 대한수의학회 Journal of Veterinary Science 7 Pages
대한수의학회 Journal of Veterinary Science 2018, 제 19권 제 1호 17 137-143 (7 pages)
characteristics of apparent diffusion coefficient maps for the brain of two dogs. J Vet Sci 2014, 15 455-458. 12. Liu S, Hu WX, Zu QQ, Lu SS, Xu XQ, Sun L, Zhou WZ, Shi HB. A novel embolic stroke model resembling lacunar infarction following proximal middle cerebral artery occlusion in beagle dogs. J Neurosci Methods 2012, 209, 90-96. 13. McConnell JF, Garosi L, Platt SR. Magnetic resonance... in a canine ischemic stroke model. T1- and T2-weighted (T1W, T2W) imaging and fluid-attenuated inversion recovery (FLAIR) sequence MRI were performed at 3 h and 3, 8, and 35 days after brain infarct induction. Diffusion-weighted imaging (DWI) and apparent diffusion coefficient (ADC) mapping were performed at 8 and 35 days. A total of 29 brain lesions were induced successfully in 12 of 14 beagle dogs. At 3 h, T2W and FLAIR detected hyperintense lesions in three randomly selected dogs. On T1W, all... -
Improved development of somatic cell cloned bovine embryos by a mammary gland epithelia cells in vitro model
Xiao-ying He, Li-bing Ma, Xiao-ning He, Wan-tong Si, Yue-Mao Zheng 대한수의학회 Journal of Veterinary Science 8 Pages
대한수의학회 Journal of Veterinary Science 2016, 제 17권 제 2호 3 145-152 (8 pages)
by RT-PCR using SuperScript Rerverse Transcriptase (Invitrogen). The gene fragment was synthesized from the cDNA using the following primer pairs: 5´GCACTCTGACCTAGCAGTCAACATG3´ and 5´GCAGGAGAATGGCGTGAACC3´. Platinum Taq DNA Polymerase (Invitrogen) was used at 0.5 L. The purified PCR product was cloned into the vector pMD18-T and then sequenced. Non-transgenic hTERT-bMGEs were used as a... a bovine mammary gland epithelia cells in vitro model by the adenovirus-mediated telomerase (hTERT-bMGEs). The present study was conducted to confirm whether hTERT-bMGEs were effective target cells to improve the efficiency of transgenic expression and somatic cell nuclear transfer (SCNT). To accomplish this, a mammary-specific vector encoding human lysozyme and green fluorescent protein was used to verify the transgenic efficiency of hTERT-bMGEs, and untreated bovine mammary gland epithelial... -
Air assisted lamellar keratectomy for the corneal haze model
Soohyun Kim, Young Woo Park, Euiri Lee, Sang Wan Park, Sungwon Park, Jong Whi Kim, Je Kyung Seong, Kangmoon Seo 대한수의학회 Journal of Veterinary Science 8 Pages
대한수의학회 Journal of Veterinary Science 2015, 제 16권 제 3호 13 349-356 (8 pages)
a standardized corneal haze model for wound size and depth by using air assisted lamellar keratectomy, which is a modification of the big bubble technique. Additionally, the occurrence of corneal haze resulting from the air assisted lamellar keratectomy was evaluated by comparing it with the occurrence of corneal haze resulting from the conventional method. Materials and Methods Experimental... To standardize the corneal haze model in the resection depth and size for efficient corneal haze development, air assisted lamellar keratectomy was performed. The ex vivo porcine corneas were categorized into four groups depending on the trephined depth: 250 μm (G1), 375 μm (G2), 500 μm (G3) and 750 μm (G4). The stroma was equally ablated at the five measurement sites in all groups. Significant differences were observed between the trephined corneal depths for resection and ablated corneal... -
Quantitative measurement of influenza virus replication using consecutive bronchoalveolar lavage in the lower respiratory tract of a ferret model
Dong-Hun Lee, Jong-In Kim, Jae-Won Lee, Wook-Hun Chung, Jae-Keun Park, Yu-Na Lee, Jin Soo Han, Hwi-Yool Kim, Sang-Won Lee, Chang 대한수의학회 Journal of Veterinary Science 4 Pages
대한수의학회 Journal of Veterinary Science 2014, 제 15권 제 3호 14 439-442 (4 pages)
used a consecutive CT scanning technique to evaluate the efficacy of an influenza vaccine using a ferret model [11]. In these previous studies, consecutive daily imaging overcame the limitations associated with necropsy performed at predefined time points after infection and enabled repeated evaluation of lung pathology in real time. CT scanning and BAL techniques in a ferret model would... The ferret is an established animal model of influenza virus infection. Although viral replication in the upper respiratory tract is usually measured with consecutively collected nasal washes, daily evaluation of viral replication in the lung is limited because a large numbers of ferrets need to be sacrificed at consecutive time points. To overcome this limitation, we performed a virus quantification assay using bronchoalveolar lavage (BAL) fluid. This non-invasive BAL technique allows... -
Laparoscopic left hepatectomy in swine: a safe and feasible technique
Hua Zhang, Tao Liu, Yue Wang, Hai-feng Liu, Jian-tao Zhang, Yan-shuang Wu, Lei Lei, Hong-bin Wang* 대한수의학회 Journal of Veterinary Science 6 Pages
대한수의학회 Journal of Veterinary Science 2014, 제 15권 제 3호 10 417-422 (6 pages)
No other abnormalities were identified. This minimally invasive left hepatectomy technique in swine could serve as a useful model for investigating liver diseases and regeneration, and offer preclinical information to improve hepatobiliary surgical procedures. Keywords: hepatectomy, laparoscopy, left, pigs, technique Introduction Liver resection is reputed to be one of the most difficult... of each resected lobe was 180 ± 51 g. Complete blood count as well as serum organics and enzyme levels normalized after about 2 weeks. During necropsy, adhesion of the hepatic raw surface to the gastric wall and omentum were observed. No other abnormalities were identified. This minimally invasive left hepatectomy technique in swine could serve as a useful model for investigating liver diseases and regeneration, and offer preclinical information to improve hepatobiliary surgical procedures. -
Comparable bone healing capacity of different bone graft matrices in a rabbit segmental defect model
Jong Min Kim, Myoung Hwan Kim, Seong Soo Kang, Gonhyung Kim, Seok Hwa Choi* 대한수의학회 Journal of Veterinary Science 7 Pages
대한수의학회 Journal of Veterinary Science 2014, 제 15권 제 2호 16 289-295 (7 pages)
Chungbuk National University, Korea. Surgical technique Zoletil (15 mg/kg) and xylazine (5 mg/kg) were injected intramuscularly for anesthesia, after which the skin was incised to separate the subcutaneous tissue and expose the radius. Each 15-mm segmental defect was created in both the left and right radiuses in 38 New Zealand White rabbits, after which the defect was filled with either DBX,... rabbit segmental defect model. Overall, 15-mm segmental defects in the left and right radiuses were created in 36 New Zealand White rabbits and filled with HA-based demineralized cortical bone matrix (DBX), CMC-based demineralized cortical bone matrix (DB) or CMC-based demineralized cortical bone with cancellous bone (NDDB), and the wound area was evaluated at 4, 8, and 12 weeks post-implantation. DBX showed significantly lower radiopacity, bone volume fraction, and bone mineral density than DB... -
Echocardiographic assessment of coronary artery flow in normal canines and model dogs with myocardial infarction
Nohwon Park, Jaehwan Kim, Miyoung Lee, Soyun Lee, Sunhye Song, Seungjun Lee, Soyoung Kim, Yangwoo Park, Kidong Eom* 대한수의학회 Journal of Veterinary Science 7 Pages
대한수의학회 Journal of Veterinary Science 2014, 제 15권 제 1호 17 149-155 (7 pages)
S. Noninvasive assessment of coronary flow velocity and coronary flow velocity reserve in the left anterior descending coronary artery by Doppler echocardiography: comparison with invasive technique. J Am Coll Cardiol 1998, 32, 1251-1259. 18. Kingma JG, Jr., Vincent C, Rouleau JR, Kingma I. Influence of acute renal failure on coronary vasoregulation in dogs. J Am Soc Nephrol 2006, 17,... the LCA and right coronary artery (RCA) were evaluated following transthoracic pulsed-wave Doppler echocardiography. The LCA was observed as an infundibular shape, located adjacent to the sinus of Valsalva. The RCA appeared as a tubular structure located 12 o’clock relative to the aorta. In normal dogs, the LCA and RCA mean peak diastolic velocities were 20.84 ± 3.24 and 19.47 ± 2.67 cm/sec, respectively. The LCA and RCA mean diastolic deceleration times were 0.91 ± 0.14 sec and 1.13 ± 0.20... -
Evaluation of a canine small intestinal submucosal xenograft and polypropylene mesh as bioscaffolds in an abdominal full-thickness resection model of growing rats
A-Jin Lee, Sung-Ho Lee, Wook-Hun Chung, Dae-Hyun Kim, Dai-Jung Chung, Sun Hee Do, Hwi-Yool Kim* 대한수의학회 Journal of Veterinary Science 10 Pages
대한수의학회 Journal of Veterinary Science 2013, 제 14권 제 2호 9 175-184 (10 pages)
undermining tissues and rotating flaps, but this technique is limited by the defect size and integrity of the abdominal wall [23]. An ideal graft would be biologically safe, secure, able to withstand tensile force, and could grow with the patient, thereby preventing body wall deformity. Previous animal studies have evaluated biologic scaffold materials composed of extracellular matrix (ECM)... We evaluated the biological scaffold properties of canine small intestinal submucosa (SIS) compared to a those of polypropylene mesh in growing rats with full-thickness abdominal defects. SIS is used to repair musculoskeletal tissue while promoting cell migration and supporting tissue regeneration. Polypropylene mesh is a non-resorbable synthetic material that can endure mechanical tension. Canine SIS was obtained from donor German shepherds, and its porous collagen fiber structure was... -
Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury
Hak-Hyun Ryu, Ji-Hey Lim, Ye-Eun Byeon, Jeong-Ran Park, Min-Soo Seo, Young-Won Lee, Wan Hee Kim, Kyung-Sun Kang*, Oh-Kyeong Kweo 대한수의학회 Journal of Veterinary Science 12 Pages
대한수의학회 Journal of Veterinary Science 2009, 제 10권 제 4호 1 273-284 (12 pages)
Y. New canine spinal cord injury model free from laminectomy. Brain Res Brain Res Protoc 2005, 14, 171-180. 11. Gimble J, Guilak F. Adipose-derived adult stem cells: ..PAGE:11 Transplantation of ASCs in spinal cord injury 283 isolation, characterization, and differentiation potential. Cytotherapy 2003, 5, 362-369. 12. Horky LL, Galimi F, Gage FH, Horner PJ. Fate of endogenous stem/progenitor... a canine spinal cord injury model. Eleven adult dogs were assigned to three groups according to treatment after spinal cord injury by epidural balloon compression: C group (no ASCs treatment as control), V group (vehicle treatment with PBS), and ASC group (ASCs treatment). ASCs or vehicle were injected directly into the injured site 1 week after spinal cord injury. Pelvic limb function after transplantation was evaluated by Olby score. Magnetic resonance imaging, somatosensory evoked potential...