자료유형
발행기관
더보기(7)-
Epigallocatechin-3-gallate rescues LPS-impaired adult hippocampal neurogenesis through suppressing the TLR4-NF-κB signaling pathway in mice
Kyung-JooSeong, Hyun-GwanLee, MinSukKook, Hyun-MiKo, Ji-YeonJung, Won-JaeKim 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 11 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2016, Vol.20 No.1 6 41-51 (11 pages)
commercial ELISA kit (R&D Systems, Minneapolis, MN, USA) as per the manufacturer's instructions, and using quantitative real-time PCR (Bio-Rad Lab. Inc., CA, USA). In detail, the total RNAs were prepared using Trizol Reagent (Gibco BRL) and reverse transcription was performed with a RT system containing Moloney Murine Leukemia Virus reverse transcriptase (Promega, Madison, WI) in accordance... Adult hippocampal dentate granule neurons are generated from neural stem cells (NSCs) in the mammalian brain, and the fate specification of adult NSCs is precisely controlled by the local niches and environment, such as the subventricular zone (SVZ), dentate gyrus (DG), and Toll-like receptors (TLRs). Epigallocatechin-3-gallate (EGCG) is the main polyphenolic flavonoid in green tea that has neuroprotective activities, but there is no clear understanding of the role of EGCG in adult neurogenesis... -
Production of transgenic pigs using a pGFAP-CreERT2/EGFP LoxP inducible system for central nervous system disease models
Seon-Ung Hwang, Kiyoung Eun, Junchul David Yoon, Hyunggee Kim, Sang-Hwan Hyun 대한수의학회 Journal of Veterinary Science 12 Pages
대한수의학회 Journal of Veterinary Science 2018, 제 19권 제 3호 13 434-445 (12 pages)
5 TG pigs had the transgenes. EGFP expression in all organs tested was confirmed by immunofluorescence staining and PCR. Real-time PCR analysis showed that pGFAP promoter-driven Cre fused to the mutated human ligand-binding domain of the estrogen receptor (CreER T2) mRNA was highly expressed in the cerebrum. Semi-nested PCR analysis revealed that CreER T2-mediated recombination was induced in... TG pigs had the transgenes. EGFP expression in all organs tested was confirmed by immunofluorescence staining and PCR. Real-time PCR analysis showed that pGFAP promoter-driven Cre fused to the mutated human ligand-binding domain of the estrogen receptor (CreERT2) mRNA was highly expressed in the cerebrum. Semi-nested PCR analysis revealed that CreERT2-mediated recombination was induced in cerebrum and cerebellum but not in skin. Thus, we successfully generated a TG pig with a 4-hydroxytamoxifen... -
Effect of donor age on the proliferation and multipotency of canine adipose-derived mesenchymal stem cells
Jienny Lee, Keum Sil Lee, Chan-Lan Kim, Jeong Su Byeon, Na-Yeon Gu, In-Soo Cho, Sang-Ho Cha 대한수의학회 Journal of Veterinary Science 8 Pages
대한수의학회 Journal of Veterinary Science 2017, 제 18권 제 2호 3 141-148 (8 pages)
using SigmaPlot (ver. 8.0; Systat Software, ..PAGE:3 Effect of donor age on stemness of mesenchymal stem cells 143 www.vetsci.org Table 1. List of primers used for reverse transcription-polymerase chain reactions Gene Primer sequence (5'-3') PCR product size Accession number Oct3/4 F: CGAGTGAGAGGCAACCTGGAGA 114 XM_538830 R: CCACACTCGGACCACATCCTTC Sox2 F: CAGACCTACATGAACGGCTCGC 147 XM_005639752 R:... Research into adipose tissue-derived mesenchymal stem cells (AD-MSCs) has demonstrated the feasibility of their use in clinical applications due to their ease of isolation and abundance in adipose tissue. We isolated AD-MSCs from young and old dogs, and the cells were subjected to sequential sub-passaging from passage 1 (P1) to P7. Canine AD-MSCs (cAD-MSCs) were examined for proliferation kinetics, expression of molecules associated with self-renewal, expression of cell surface markers, and... -
TRPV1 in Salivary Gland Epithelial Cells Is Not Involved in Salivary Secretion via Transcellular Pathway
SeulkiChoi, Yong-HwanShin, EunNamkoong, Sung-MinHwang, XinCong, GuangyanYu, KyungpyoPark 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 6 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2014, Vol.18 No.6 12 525-530 (6 pages)
of denaturation at 95 o C for 30 sec, an- nealing at 55 o C for 30 sec, extension at 72 o C for 30 sec, and a final step at 72 oC for 10 min. The primers used are listed in Table 1. Quantitative Real-time PCR Total RNA was extracted from DRG and SMG in mice with Trizol (Invitrogen) according to the manufacturer’s protocol. One microgram of total RNA was converted to cDNA with Superscript II... Transient receptor potential vanilloid subtype 1 (TRPV1) was originally found in sensory neurons. Recently, it has been reported that TRPV1 is expressed in salivary gland epithelial cells (SGEC). However, the physiological role of TRPV1 in salivary secretion remains to be elucidated. We found that TRPV1 is expressed in mouse and human submandibular glands (SMG) and HSG cells, originated from human submandibular gland ducts at both mRNA and protein levels. However, capsaicin (CAP), TRPV1 agonist,... -
컴포넌트 기반 실시간 임베디드 소프트웨어 프러덕트 라인을 위한 코드 생성 시스템
최승훈, Choi. Seung-Hoon 한국인터넷정보학회 인터넷정보학회논문지 12 Pages
한국인터넷정보학회 인터넷정보학회논문지 2006, Vol.7 No.4 11-22 (12 pages)
소프트웨어 프러덕트 라인 개발 방법론이란, 개발 초기에 시스템의 공통적인 부분과 가변적인 부분을 명확히 하여 소프트웨어 자산을 구축한 후 요구 사항에 따라 가변적인 부분을 커스터마이징하여 목표 시스템을 생성하는 소프트웨어 개발 패러다임이다. 일반적인 소프트웨어 프러덕트 라인에 대한 연구는 활발히 진행되고 있지만, 컴포넌트 기반의 실시간 임베디드 소프트웨어 프러덕트 라인에 대한 연구는 상대적으로 미약하다. 본 논문에서는 실시간 임베디드 소프트웨어 프러덕트 라인구축의 생산성 향상을 위해, 특성 모델을 통해... -
Effective Estimation Software cost using Test Generations
Sattarova Feruza, Farkhod Alisherov 인문사회과학기술융합학회 예술인문사회융합멀티미디어논문지 10 Pages
인문사회과학기술융합학회 예술인문사회융합멀티미디어논문지 2011, 제 1권 제 1호 1 1-10 (10 pages)
Size of Test Suites from Use Cases”, Software Engineering Conference, 2008, APSEC '08, 15th Asia-Pacific, (2008), December 3-5, pp. 487 - 492. [10] H. Kim, “Testing Software Requirements with Z and Statecharts Applied toan Embedded Control System”, Software Quality Jr. Special Issue on Software Measurement, Kluwer, Dordrecht Netherlands, (2002) December. [11] B. Korel, “Automated Test Data... failed to give the correct software estimation that really challenges the all factors of perfect software in this paper we use software requirement specification but we were not getting the accurate results that are helpful for developing of perfect software that is having perfect cost estimation. So we introduce the Automated Test-Data Generation Techniques method that gives us the desired results which will be helping us to know the software cost estimation very much accurately and also estima... -
The Appreciation and Experience of Digital Images- Critical Review of Use of Digital Images in Museum Environment -
Bokyung Koo 한국조형교육학회 조형교육 29 Pages
한국조형교육학회 조형교육 2009, 제 34집 2 1-29 (29 pages)
As Museum curator Kevin Sumption (2000) observed: ...the real confusion arises when collection turns to display and in an effort to meet public expectation, contemporary and historic hardware and software is seamlessly reinterpreted via interactive multimedia. In essence, computers presenting ideas and concepts about computers...this is the issue that confronted my museum colleagues and I as we... Art museums are dedicated to fostering an understanding of works of art, to conducting research, and to delivering results to the public. As technologies has introduced new challenges for museums, museum professionals have embraced new interactive technologies for their promise to offer aesthetic, cultural, and contextual information on exhibits, and to boost museum attendance. Museum visitors, expecially children and young adults, have responded enthusiastically to interactive exhibits, even... -
The Protective Role of TLR3 and TLR9 Ligands in Human Pharyngeal Epithelial Cells Infected with Influenza A Virus
YanHan, Zhi-jianBo, Ming-yuXu, NanSun, Dan-hongLiu 대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 7 Pages
대한생리학회-대한약리학회 The Korean Journal of Physiology & Pharmacology 2014, Vol.18 No.3 5 225-231 (7 pages)
a QIAxcel instrument (Qiagen) using QIAxcel ScreenGel Software. Quantitative real-time reverse transcription PCR (qRT- PCR) Real-time quantitative PCR was performed as described in SYBR Premix Ex Taq TM II (TaKaRa, Dalian, China). Briefly, 2 μl of cDNA was combined with SYBR Premix Ex Taq TM II, 0.8 μl of primers (10 μM), 0.4 μl of ROX ..PAGE:3 Antiviral Role of TLR Ligands in Hep-2 227... In this study we aim to extensively investigate the anti-influenza virus immune responses in human pharyngeal epithelial cell line (Hep-2) and evaluate the protective role of Toll-like receptor (TLR) ligands in seasonal influenza A H1N1 (sH1N1) infections in vitro. We first investigated the expression of the TLRs and cytokines genes in resting and sH1N1 infected Hep-2 cells. Clear expressions of TLR3, TLR9, interleukin (IL)-6, tumour necrosis factor (TNF)-α and interferon (IFN)-β were detected... -
Conceptualisations of Parent Involvement in Early Childhood Education in China
Yan Li, Michel Vandenbroeck 환태평양유아교육연구학회 Asia-Pacific journal of research in early childhood education 24 Pages
환태평양유아교육연구학회 Asia-Pacific journal of research in early childhood education 2020, Vol.14 No.1 8 169-192 (24 pages)
priority in policy documents. Embedded in the concrete context of China, parent involvement and children’s development have a very long tradition and familial influences on children, parental self- cultivation and parents’ teaching good morality to children are inherited values that date from the Warring States period (Zou, 2008). Since 220 BC, Confucianism has taken a dominant position and... There is a growing attention for parent involvement in education in general and in early childhood education in particular. The vast majority of scholarly literature is published in English language and originates from Western countries. There is a risk that this may lead to the assumption that mainstream ideas in international literature are globally valid and come to dominate those of other countries, despite cultural differences. We conducted a systematic review of Chinese literature on... -
The Search for Creative Networks in Guanxi Land: A Study of Social Networking related to Shanghai Expo 2010
LeeYuHsuan 한국여가문화학회 여가학연구 28 Pages
한국여가문화학회 여가학연구 2008, Vol.6 No.1 1 7-34 (28 pages)
a broad sense of how people share their information, goods, and social relationships. On the Internet, for example, expensive journals, software, and music are increasingly circulated by people who ca n u s e c r y p t o l o g y technology without being tracked, e.g., hackers. Internet users widely engage in a quest for new forms of sociality and a reconfiguration of cultural hierarchies. They...


전체 선택해제

총

