자료유형
전체 선택해제
총 11건 검색
본문검색 결과만 보기
-
Selection and a 3-Year Field Trial of Sorangium cellulosum KYC 3262 Against Anthracnose in Hot Pepper
한국식물병리학회 The Plant Pathology Journal 9 Pages
한국식물병리학회 The Plant Pathology Journal 2014, 30권 3호 6 279-287 (9 pages)
clear zone due to blocking of spore germination of the pathogens Myxobacterial type Reference a Inhibition of mycelial growth Clear zone due to blocking of spore germination Complete inhibition Delayed growth Non- inhibition 20-30 mm 10-20 mm <10 mm None Cellulolytic Kim and Yun (2011a) 29/318 b 149/318 140/318 5/318 41/318 3/318 269/318 In this study 68/218 67/218 83/218 1/218 35/218 7/218... KYC 3262 was selected as a biocontrol agent against anthracnose on hot pepper from 813 extracts of myxobacterial isolates. Dual culture with Colletotrichum acutatum and 813 myxobacterial extracts was conducted, and 19 extracts were selected that inhibited germination and mycelial growth of C. acutatum. All selections were Sorangium cellulosum, which are cellulolytic myxobacteria from soil. With the infection bioassay on detached fruits in airtight containers, KYC 3262, KYC 3512, KYC 3279, and... -
Fusarium Species from Sorghum in Thailand
Nik M. I. Mohamed Nor, Baharuddin Salleh, John F. Leslie 한국식물병리학회 The Plant Pathology Journal 12 Pages
한국식물병리학회 The Plant Pathology Journal 2019, 35권 4호 2 301-312 (12 pages)
Seventy-eight polymorphic AFLP bands were scored manually as the presence or absence of the band. All of the isolates from the same species clustered in unique clades in an unrooted tree (Fig. 1). Reference strains were included in this analysis. Identity of isolates that did not cluster with a reference strain, e.g., F. beomiforme, was confirmed with partial tef-1 gene sequences. Analysis o... its drought tolerance, and when cultivated in Southeast Asia commonly occurs as a second crop during the dry season. We recovered Fusarium from sorghum in Thailand and found F. proliferatum, F. thapsinum and F. verticillioides most frequently, and intermittent isolates of F. sacchari and F. beomiforme. The relatively high frequencies of F. proliferatum and F. verticillioides, suggest mycotoxin contamination, particularly fumonisins and moniliformin, should be evaluated. Genetic variation within... -
Optimization of a Virus-Induced Gene Silencing System with Soybean yellow common mosaic virus for Gene Function Studies in Soybeans
한국식물병리학회 The Plant Pathology Journal 11 Pages
한국식물병리학회 The Plant Pathology Journal 2016, 32권 2호 5 112-122 (11 pages)
a reference genome sequence of a cultivated soybean (G. max var. Williams 82) was released, and dozens of wild and cultivated soybeans have been resequenced (Kim et al., 2010; Lam et al., 2010; Schmutz et al., 2010). Furthermore, recent advances in next generation sequencing technologies have been applied to soybean research, leading to a large number of candidate genes. These genomic... Virus-induced gene silencing (VIGS) is an effective tool for the study of soybean gene function. Successful VIGS depends on the interaction between virus spread and plant growth, which can be influenced by environmental conditions. Recently, we developed a new VIGS system derived from the Soybean yellow common mosaic virus (SYCMV). Here, we investigated several environmental and developmental factors to improve the efficiency of a SYCMV-based VIGS system to optimize the functional analysis of... -
Genetic Variability and Geographical Distribution of Mycotoxigenic Fusarium verticillioides Strains Isolated from Maize Fields in Texas
한국식물병리학회 The Plant Pathology Journal 9 Pages
한국식물병리학회 The Plant Pathology Journal 2015, 31권 3호 1 203-211 (9 pages)
this study Name Sequence (5-3-) Reference Gfmat1a GTTCATCAAAGGGCAAGCG Steenkamp et al., 2000 Gfmat1b TAAGCGCCCTCTTAACGCCTTC Steenkamp et al., 2000 Gfmat2c AGCGTCATTATTCGATCAAG Steenkamp et al., 2000 Gfmat2d CTACGTTGAGAGTGTACAG Steenkamp et al., 2000 FvFum-F TCACGAACCCTTGAAAGCAG Shim and Woloshuk, 2001 FvFum-R TACAAATTGTCCACGAGGCG Shim and Woloshuk, 2001 UBC-18 GGGCCGTTTA Moller et al., 1999 OPA-01... Maize is the dominant cereal crop produced in the US. One of the main fungal pathogens of maize is Fusarium verticillioides, the causative agent of ear and stalk rots. Significantly, the fungus produces a group of mycotoxins - fumonisins - on infested kernels, which have been linked to various illnesses in humans and animals. Nonetheless, durable resistance against F. verticillioides in maize is not currently available. In Texas, over 2.1 million acres of maize are vulnerable to fumonisin... -
The Symbolic Meaning of the Tree in Korean Traditional Faith and Rituals
Park Boo Jin 한국모래놀이치료학회 모래놀이상담연구 14 Pages
한국모래놀이치료학회 모래놀이상담연구 2014, 제 10권 제 1호 6 95-108 (14 pages)
One day two old men, living near the tree, decided not to cut down the tree and demolished their servant's quarters instead to use as firewood in the winter. During the farming season in the next year, one old man worried that he couldn't find anyone to harvest the crops. A young man came and asked if he could work for the old man. Because of the young man, the harvest was good and the old man... The analysis in the system of symbol and meaning is an essential task to understand the human subject. This analysis is so in the view of not only the anthropological perspective in which human is the cultural beings but also the analytical psychology in which human is a community sharing the group unconscious. The symbol of all human groups have qualified, or shared the system of symbol on faith that has shaped the development of new knowledge. From ancient times, the variety of human... -
기후변화를 고려한 안성천 유역의 미래 물 부족량 평가
이대웅, 정재원, 홍승진, 한대건, 주홍준, 김형수 한국습지학회 한국습지학회지 8 Pages
한국습지학회 한국습지학회지 2017, Vol.19 No.3 11 345-352 (8 pages)
Reference(관측기간) : 1981년 - 2011년 - Target Period I : 2011년 - 2040년 - Target Period II : 2041년 - 2070년 - Target Period III : 2071년 - 2099년 미래기간의 홍수기, 갈수기의 유출특성 변동을 파악하기 위해 관측기간(1981-2011년)과 미래기간의 유출특성을 계 절별로 구분하여 비교·분석하였다. 그 결과 Fig. 2와 같이 관 측기간이 미래기간에 비해 적은 강우에도 큰 유출량을 나타 내는 것으로 확인되었다. 특히... 지구온난화에 의해 지구의 평균 기온은 1880년 이후로 약 0.85℃ 상승하였다. 이는 수문현상에 영향을 미치며 이로 인해 전 세계는 홍수 및 가뭄과 같은 자연재해에 어려움을 겪고 있다. 따라서 미래의 안정적인 물 공급을 위한 수자원 계획 수립을 위해 특히 물 부족 측면에서 기후의 불확실성을 고려한 물 수요의 정확한 예측이 필요하다. 이를 위해 본 연구에서는 한국의 안성천 유역을 대상으로 기후변화를 고려하여 미래 물수지 및 물 부족량을 평가하였다. RCP 8.5 기후변화 시나리오를 이용하여 미래 강수량을 모의하였고, 준분포... -
토지이용변화에 따른 미계측 유역의 기저유출량 산정 및 평가
이지민, 신용철, 박윤식, 금동혁, 임경재, 이승오, 김형수, 정영훈 한국습지학회 한국습지학회지 16 Pages
한국습지학회 한국습지학회지 2014, Vol.16 No.4 1 303-318 (16 pages)
연구는 한국환경산업기술원 GAIA Project (No: 2012000540017) “식생조절 방안/공학적 저감 공법/토 지개발사업 토양침식 저감 공법 개발”의 연구비 지원 으로 수행되었으며, 이에 깊은 감사를 드립니다. Reference Abbaspour, KC, Yang, J, Maximov, I, Siber, R, Bonger, K, Mieleitner, J, Zobrist, J and Srinivasan, R (2007). Modelling Hydrology and Water Quality in the Pre-alpine Thur Watershed using SWAT,... 기후변화와 도시화는 기저유출이 하천유량에 미치는 계절별 특성에 변동성을 초래한다. 이러한 기저유출의 변동성은 수 생태의 혼란을 유발할 뿐만 아니라 불안정한 수자원 관리를 초래할 수 있다. 토지이용변화는 직접유출과 기저유출에 영 향을 주며, 결과적으로 다른 수문순환 요소들에게 미치게 된다. 일반적으로 기저유출은 관측된 하천유량을 통해 산정되지 만, 모델링의 유량 예측을 통해서 미계측 유역의 기저유출량 산정에 유용하게 사용 될 수 있다. 따라서, 본 연구의 목적 은 1) RECESS 통해 alpha factor를 산정한 후, SWAT... -
수문곡선의 감수부 특성을 고려한 기저유출 산정
정영훈, 임경재, 김형수 한국습지학회 한국습지학회지 11 Pages
한국습지학회 한국습지학회지 2014, Vol.16 No.2 1 161-171 (11 pages)
a multi-year drought, Water resources management, 20(6), pp. 991-1006. Kim, NW, Chung, IM and Won, YS (2005). Method of estimating groundwater recharge with spatial-temporal variability, J. of Korea Water Resource Association, 38(7),pp.517-526. Kim, HT and Shin, HS (2009). The development and application of GIS-based geomorpho-hydrological watershed model (G2WMS), J. of Korean Society of Hazard... 수문곡선의 감수부는 기저유출의 특성을 반영하기 때문에 강우유출 모형과 기저유출분리법을 이용한 기저유출 산정 과정에서 감수부의 특성을 고려해야한다. 따라서 본 연구는 감수특성을 고려하여 Soil and Water Assessment Tool (SWAT)의 보정에서 유량예측의 정확성을 높이고, 보정된 SWAT으로부터 예측된 유량으로부터 기저유출을 분리하고 자 하였다. 이를 위하여 RECESS으로부터 산정된 alpha factor와 11개의 다른 매개변수를 자동보정모듈에 적용한 시 나리오 (S1)와 SWAT의 매개변수인 alpha factor를 포함한 12개의 매개변수를... -
농업가뭄대응을 위한 가뭄기상시나리오 모델 개발 및 적용
유승환, 최진용, 남원호, 김태곤, 고광돈, Yoo. Seung-Hwan, Choi. Jin-Yong, Nam. Won-Ho, Kim. Tae-Gon, Go. Gwang-Don 한국농공학회 한국농공학회논문집 9 Pages
한국농공학회 한국농공학회논문집 2012, Vol.54 No.2 67-75 (9 pages)
-
The Evolution of Councils of Nobles in Silla Korea
Richard D. McBride 동국역사문화연구소 동국사학 56 Pages
동국역사문화연구소 동국사학 2015, 제 59집 8 263-318 (56 pages)
thank Lee Sungshi 李成市 for this reference. 34) 李基白, 新羅政治社會史硏究, 89～132쪽. ..PAGE:18 280 동국사학 59집 (2015.12) equals, it would seem rather that the opposite was actually the case. In other words, the senior grandee was a close supporter of the Silla king rather than an opponent because the kalmunwang already functioned as the representative of noble authority.35) The Silla king... This study analyzes two related questions dealing with the early Korean state of Silla: What was the nature of councils of nobles in Silla? And how did these councils evolve as Silla adopted and adapted Chinese-style statecraft and bureaucratic systems? It separates Silla history into three periods: (1) 531 and before; (2) 531-647; and (3) 647-935. In the first period, nobles from regions the Silla capital, who were all “kings,” gathered to decide important matters. The rank-title taed?ng...