발행기관
- 한국식물병리학회(31)
- 대한수의학회(28)
- 한국미생물생명공학회(2)
- 대한기생충학회(1)
- 한국생명과학회(1)
- 한국약용작물학회(1)
- 한국원예학회(1)
- 한국잠사학회(1)
- 한방비만학회(1)
간행물
- THE PLANT PATHOLOGY JOURNAL (26)
- JOURNAL OF VETERINARY SCIENCE(11)
- KOREAN JOURNAL OF VETERINARY RESEARCH(구 대한수의학회지)(9)
- 대한수의학회 학술대회발표집(8)
- 식물병연구(5)
- HORTICULTURE, ENVIRONMENT, AND BIOTECHNOLOGY(1)
- JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY(1)
- THE KOREAN JOURNAL OF PARASITOLOGY(1)
- 대한한방비만학회지(1)
- 생명과학회지(1)
- 한국미생물-생명공학회지(1)
- 한국약용작물학회지(1)
- 한국잠사학회지(1)
전체 선택해제
총 67건 검색
본문검색 결과만 보기
-
Molecular Characterization of Mycoplasma gallisepticum Isolates from Chickens in South Korea by Random Amplification of Polymorphic DNA (RAPD) Analysis and Gene-targeted Sequencing (GTS)
Byung Woo Jeon, Ok Mi Jeong, Byung Kook Choi, So Youn Youn, Hye Jin Lee, Hee Soo Lee, Min Su Kang 대한수의학회 대한수의학회 학술대회발표집 2 Pages
대한수의학회 대한수의학회 학술대회발표집 추계학술심포지움 189 294-295 (2 pages)
in wild boars. Acta Vet Hung. 59(1):149-154. [2] OIE. 2013. Manual of diagnostic tests and vaccines for terrestrial animals. Chapter 2.1.13. Rabies. pp. 6-13. P-129 Molecular Characterization of Mycoplasma gallisepticum Isolates from Chickens in South Korea by Random Amplification of Polymorphic DNA (RAPD) Analysis and Gene-targeted Sequencing (GTS) Byung Woo Jeon 1, Ok Mi Jeong 1, Byung Kook... -
Random Amplification of Polymorphic DNA와 혈청학적 분석을 이용한 국내식품에서 분리한 Listeria monocytogenes의 분류
김현중, 박시홍, 김해영, Kim. Hyun-Joong, Park. Si-Hong, Kim. Hae-Yeong 한국미생물생명공학회 한국미생물·생명공학회지 5 Pages
한국미생물생명공학회 한국미생물·생명공학회지 2006, Vol.34 No.1 23-27 (5 pages)
본 연구에서는 국내시장에서 유통되는 육류, 냉동식품, 생우유, 조개류 등과 같은 식품으로부터 L. monocytogenes들을 분리하고 혈청형을 결정하였다. RAPD 결과를 통해서 L. monocytogenes는 Listeria 속의 다른 균주들과 전체 밴드의 수와 크기에서 구별이 되었다. 또한, L. monocytogenes는 2개 그룹으로 구별되었으며, 그룹 I은 L. monocytogenes 1/2b, 4e, 4b, 그룹 II는 L. monocytogenes 1/2a, 1/2c, 3 혈청형 그룹별로 분류되었다. 결론적으로 RAPD 방법과 serotyping은 L. monocytogenes를 분류하는 데에 있어서 기존의 방법의... -
Random amplified polymorphic DNA (RAPD) analysis of Mycobacterium tuberculosis strains in India
J. P. N. Singh, Rishendra Verma, P. Chaudhuri 대한수의학회 Journal of Veterinary Science 7 Pages
대한수의학회 Journal of Veterinary Science 2006, 제 7권 제 2호 15 181-187 (7 pages)
the Indian strains indicates the need for alternate rapid procedures. Random amplification of polymorphic DNA (RAPD) is a multiplex PCR-based molecular system [27,28]. This method uses short oligonucleotide primers of an arbitrary sequence, and low-stringency PCR, to amplify discrete DNA fragments that can be used as molecular markers. RAPD analysis is rapid, inexpensive, easy to perform and can... The usefulness of random amplification of polymorphic DNA (RAPD) analysis for typing Indian strains of M. tuberculosis was investigated. M. tuberculosis H37Rv, M. tuberculosis DT and 42 clinical isolates of M. tuberculosis were subjected to RAPD-PCR using 7 random decamer primers. All 7 primers were found to be differentiated and produced specific RAPD profiles. The polymorphic amplicons served as RAPD markers for M. tuberculosis. The dendrograms, obtained by different primers, showed the... -
Protein Misfolding Cyclic Amplification of CWD Prion Protein in Soil
Kyung Je Park, Hyun Joo Sohn, In Soon Roh, Hyo Jin Kim, Byoung han Kim 대한수의학회 대한수의학회 학술대회발표집 2 Pages
대한수의학회 대한수의학회 학술대회발표집 추계학술심포지움 179 429-430 (2 pages)
cecum and leftoverfood, can be inferred the same size band from Single-tube nested PCR assayresult. Botulism is estimated that infected by leftover food. Will need geneticepidemiological analysis of a pathogen like PFGE ( Pulsed-Field Gel Electrophoresis) or RAPD (Random Amplified Polymorphic DNA). P-096 Antibiotic Resistance and Genetic relatedness of Campylobacter jejuni isolates from Far... -
DNA fingerprinting of Brucella abortus isolated from bovine brucellosis outbreaks by repetitive element sequence (rep)-PCR
DongKyunSuh 대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 7 Pages
대한수의학회 Korean Journal of Veterinary Research(구 대한수의학회지) 2005, 제 45권 제 2호 9 199-205 (7 pages)
as a monospecific genus [23]. Several techniques have been employed to find DNA polymorphisms, which would enable the molecular typing of Brucella species and their biovars. One of the genetic targets frequently used for the identification and phylogeny of strain is the rRNA operon, particularly the 16S rRNA gene. These genes are highly conserved and diverge very slowly. The DNA sequences within a... -
Identification of Coupling and Repulsion Phase DNA Marker Associated With an Allele of a Gene Conferring Host Plant Resistance to Pigeonpea sterility mosaic virus (PPSMV) in Pigeonpea (Cajanus cajan L. Millsp.)
한국식물병리학회 The Plant Pathology Journal 8 Pages
한국식물병리학회 The Plant Pathology Journal 2015, 31권 1호 4 33-40 (8 pages)
amplicon. Primers showing expected segre- gation in subsets were tested across all F2 plants and the marker data was compared with the field phenotypic data for PSMD resistance. Short decamer random DNA marker analysis. The decamer random DNA marker reactions were performed in 25 μl volumes in 100 μl PCR tubes (Tarson Pvt Ltd, India). The reaction mixture contained 50 ng of template DNA, 1... a set of 32 out of 300 short decamer random DNA markers that showed polymorphism between Gullyal white and BSMR 736 parents. Among them, eleven DNA markers showed polymorphism including coupling and repulsion phase type of polymorphism across the parents. Bulked Segregant Analysis (BSA), revealed that the DNA marker, IABTPPN7, produced a single coupling phase marker (IABTPPN7;sub>414;/sub>) and a repulsion phase marker (IABTPPN7;sub>983;/sub>) co-segregating with PSMD reaction.... -
Development of Diagnostic Technology of Xylella fastidiosa Using Loop-Mediated Isothermal Amplification and PCR Methods
Suyoung Kim, Yujin Park, Gidon Kim 한국식물병리학회 식물병연구 7 Pages
한국식물병리학회 식물병연구 2021, 27권 1호 6 38-44 (7 pages)
(rpoD) Bleve et al. (2016) Xfa-rpod-R4CCTCAGGCATGTCCATTTCC mqsA-F ATGCTTTACACCTATAAGC 402 Grapevine Type II toxin-antitoxin system MqsA family antitoxin mqsA-R ATCCAGAAGCTTGAATAACTT RAPD, random amplified polymorphic DNA. ..PAGE:3 Research in Plant Disease Vol. 27 No. 1 40 complicated equipment. After exploring different gene sites linked to the diagnosis of X. fastidiosa, primers were... pathogen in many parts of the world. To increase diagnostic capability of X. fastidiosa in the field, the loop-mediated isothermal amplification (LAMP) and polymerase chain reaction (PCR) assay were developed to mqsA gene of citrate-synthase (XF 1535) X. fastidiosa and evaluated for speci- ficity and sensitivity. Both assays were more robust than current published tests for detection of X. fastidiosa when screened against 16 isolates representing the four major subgroups of the bacterium from a... -
Antibiotic Resistance and Genetic relatedness of Campylobacter jejuni isolates from Farm Animals
Jae Uk An, Hung wui Ho, Hee Jin Dong, Woo hyun Kim, Jun hyung Kim, Seong beom Cho 대한수의학회 대한수의학회 학술대회발표집 1 Pages
대한수의학회 대한수의학회 학술대회발표집 추계학술심포지움 178 429-429 (1 pages)
cecum and leftoverfood, can be inferred the same size band from Single-tube nested PCR assayresult. Botulism is estimated that infected by leftover food. Will need geneticepidemiological analysis of a pathogen like PFGE ( Pulsed-Field Gel Electrophoresis) or RAPD (Random Amplified Polymorphic DNA). P-096 Antibiotic Resistance and Genetic relatedness of Campylobacter jejuni isolates from Far... -
Characterization of Clostridium perfringens and Bacteriophages Isolated from Chicken and Animal Application
Sa ra Kim, You Chan Bae 대한수의학회 대한수의학회 학술대회발표집 2 Pages
대한수의학회 대한수의학회 학술대회발표집 춘계학술심포지움 36 155-156 (2 pages)
bacteriophages were obtained from chicken feces, and the host spectrum was researched by spot and standard plaque assay. The genetic diverse of bacteriophages were determined with Random Amplified Polymorphic DNA (RAPD) method. Day-old commercial broiler chicken were used to examine the effectivess of a bacteriophage (SJ Ф21) in treatment. Results: The isolated C. perfringens were resistant... -
Monitoring of Bovine Tuberculosis from free-ranging wildlife from 2015 to 2016
Yun-ho Jang, Yu Sin Ok, Tae woon Kim, Mi Hye Hwang, Jong Taek Kim, So young Park, Woong seog Song, Jip-seol Jeong, Suk Chan Jung, Jae Myu 대한수의학회 대한수의학회 학술대회발표집 2 Pages
대한수의학회 대한수의학회 학술대회발표집 추계학술심포지움 97 237-238 (2 pages)
Kyungpook National University, Daegu, Republic of Korea Introduction: Clostridium tetani released neurotoxin (tetanospasmin) that was a powerful exotoxin encoded on a plasmid [1]. Regardless of neurotoxin producing ability, all of the C. tetani strains had surface-layer protein (slp) gene encoded on a chromoso me. Random amplification of polymorphic DNA (RAPD) markers were DNA fragments...